ID: 985101318_985101321

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 985101318 985101321
Species Human (GRCh38) Human (GRCh38)
Location 4:186461319-186461341 4:186461351-186461373
Sequence CCATCTTAACAAAAGAACAAGAA GAAGTAGCAACACAAGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 15, 3: 637, 4: 10287} {0: 1, 1: 0, 2: 1, 3: 18, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!