ID: 985105187_985105195

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 985105187 985105195
Species Human (GRCh38) Human (GRCh38)
Location 4:186492743-186492765 4:186492784-186492806
Sequence CCCACCATGTGATTAGGGAGTCG TTAGTGGCCTGACTCTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 58, 4: 175} {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!