ID: 985128827_985128836

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 985128827 985128836
Species Human (GRCh38) Human (GRCh38)
Location 4:186722082-186722104 4:186722101-186722123
Sequence CCCGCCTCGACCTCCCATAGGGC GGGCTGGGTTTACAGGCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 25, 2: 3382, 3: 100209, 4: 239892} {0: 1, 1: 8, 2: 1028, 3: 2898, 4: 3355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!