|
Left Crispr |
Right Crispr |
| Crispr ID |
985128827 |
985128837 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:186722082-186722104
|
4:186722113-186722135
|
| Sequence |
CCCGCCTCGACCTCCCATAGGGC |
CAGGCGTGAGGCACTACGCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 25, 2: 3382, 3: 100209, 4: 239892} |
{0: 3, 1: 389, 2: 20286, 3: 98374, 4: 182175} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|