ID: 985131739_985131752

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 985131739 985131752
Species Human (GRCh38) Human (GRCh38)
Location 4:186745489-186745511 4:186745538-186745560
Sequence CCCAGAGCCAGCAAATGAAATAT CAGGGCAGTGCAGTGATGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 38, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!