ID: 985189781_985189788

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 985189781 985189788
Species Human (GRCh38) Human (GRCh38)
Location 4:187360270-187360292 4:187360316-187360338
Sequence CCATTGCATATAACAGATCTGTT TTGTATTTGGGGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 527} {0: 1, 1: 1, 2: 3, 3: 54, 4: 549}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!