ID: 985234749_985234757

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 985234749 985234757
Species Human (GRCh38) Human (GRCh38)
Location 4:187860902-187860924 4:187860941-187860963
Sequence CCGGTTGTTCCTTTCCATGTTTA CTCTTTTAGGGCATGCTCGGTGG
Strand - +
Off-target summary {0: 3944, 1: 1849, 2: 1027, 3: 545, 4: 546} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!