ID: 985323280_985323298

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 985323280 985323298
Species Human (GRCh38) Human (GRCh38)
Location 4:188738434-188738456 4:188738485-188738507
Sequence CCGGTAGCCCGCCGCTGGAGAAG CCTTCCTCGAGCGCCAGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 57} {0: 2, 1: 0, 2: 0, 3: 11, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!