ID: 985323473_985323476

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 985323473 985323476
Species Human (GRCh38) Human (GRCh38)
Location 4:188740504-188740526 4:188740549-188740571
Sequence CCAGACAAACTTCCTTAAAAGGA AGTCTAACAAGTCCAAAAGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!