ID: 985331750_985331759

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 985331750 985331759
Species Human (GRCh38) Human (GRCh38)
Location 4:188844902-188844924 4:188844941-188844963
Sequence CCATTCTACTGCAACAAACAGCC TTATTTATTCATTATTAATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 14, 3: 153, 4: 1409}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!