ID: 985350731_985350744

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 985350731 985350744
Species Human (GRCh38) Human (GRCh38)
Location 4:189058645-189058667 4:189058691-189058713
Sequence CCGTCCACCACCGCTGTTGTCTG TCTCCCCTCCGGATCTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 269} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!