ID: 985378569_985378570

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 985378569 985378570
Species Human (GRCh38) Human (GRCh38)
Location 4:189368296-189368318 4:189368315-189368337
Sequence CCTGTAACATTGGAAAAAAAAAA AAAAAAAAAGAAAGAAAATGAGG
Strand - +
Off-target summary No data {0: 35, 1: 295, 2: 1821, 3: 15765, 4: 67232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!