ID: 985403797_985403798

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 985403797 985403798
Species Human (GRCh38) Human (GRCh38)
Location 4:189616594-189616616 4:189616616-189616638
Sequence CCGCACAGGGGCTGCAGGTGGAG GCTGCCTGCCAGTCCCGCGCCGG
Strand - +
Off-target summary {0: 44, 1: 422, 2: 402, 3: 280, 4: 503} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!