|
Left Crispr |
Right Crispr |
| Crispr ID |
985433795 |
985433798 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:189907774-189907796
|
4:189907798-189907820
|
| Sequence |
CCAATGTCAAGAATGTTTTCTCC |
GTCTTCTTCTAGGAGTTTTATGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 57, 2: 1024, 3: 15538, 4: 6311} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|