ID: 985434648_985434654

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 985434648 985434654
Species Human (GRCh38) Human (GRCh38)
Location 4:189917086-189917108 4:189917116-189917138
Sequence CCTTACCTTTGGGTGTCTTCTGG TGTGCTGCAGGTCATGGCTCCGG
Strand - +
Off-target summary No data {0: 4, 1: 2, 2: 2, 3: 20, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!