ID: 985438152_985438156 |
View in Genome Browser |
Spacer: 6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 985438152 | 985438156 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:189954014-189954036 | 4:189954043-189954065 |
| Sequence | CCCAGTAGAAAAACTGCGAACAA | CTCAATAGAAAAATGGACAAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 14, 2: 71, 3: 379, 4: 1642} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||