ID: 985462652_985462660

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 985462652 985462660
Species Human (GRCh38) Human (GRCh38)
Location 4:190121598-190121620 4:190121645-190121667
Sequence CCTGCGCCGCGGCGGCGTCCGTC CCGTCTCTGCGCCTGCGCCGCGG
Strand - +
Off-target summary No data {0: 9, 1: 2, 2: 4, 3: 20, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!