ID: 985462667_985462676

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 985462667 985462676
Species Human (GRCh38) Human (GRCh38)
Location 4:190121685-190121707 4:190121735-190121757
Sequence CCTGCGCCGCGGCGGCGTCCGTC TCTCTGCGCCTGCGCCGCGGCGG
Strand - +
Off-target summary {0: 9, 1: 2, 2: 6, 3: 29, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!