ID: 985478267_985478277

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 985478267 985478277
Species Human (GRCh38) Human (GRCh38)
Location 5:91914-91936 5:91966-91988
Sequence CCACAAAATGGCAGGTCCCCGAG GCCACTGCCGCCCGCGCTCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!