ID: 985487261_985487274

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 985487261 985487274
Species Human (GRCh38) Human (GRCh38)
Location 5:158560-158582 5:158600-158622
Sequence CCTCTGCCCGTCCTGGGAGTCTC CGTTCTACTCCGTCCTTGGGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 25, 4: 238} {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!