ID: 985499341_985499349

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 985499341 985499349
Species Human (GRCh38) Human (GRCh38)
Location 5:231836-231858 5:231874-231896
Sequence CCCATGTGACATTGGGCGCTGGG CACTGAGAGAGCTTGTCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 10, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!