ID: 985502041_985502044

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 985502041 985502044
Species Human (GRCh38) Human (GRCh38)
Location 5:254428-254450 5:254445-254467
Sequence CCAGGGGCAACAGAAGAAGCCCT AGCCCTTTGAGGAGCACTGGAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 3, 3: 27, 4: 292} {0: 3, 1: 1, 2: 1, 3: 13, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!