ID: 985511529_985511537

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 985511529 985511537
Species Human (GRCh38) Human (GRCh38)
Location 5:316759-316781 5:316779-316801
Sequence CCAGAGCAGAAGTTCTTCAGCAG CAGAGGGTGAGGAGGGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 493} {0: 1, 1: 0, 2: 5, 3: 74, 4: 927}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!