ID: 985511631_985511645

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 985511631 985511645
Species Human (GRCh38) Human (GRCh38)
Location 5:317162-317184 5:317208-317230
Sequence CCACACTGCCAGCACAGACCCCA CACCCACGCCTTCCTGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 93, 4: 586} {0: 1, 1: 0, 2: 1, 3: 30, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!