ID: 985519436_985519439

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 985519436 985519439
Species Human (GRCh38) Human (GRCh38)
Location 5:366104-366126 5:366136-366158
Sequence CCTCGGAACAGTGACACCCTAGC CACACCTAACATTCAGATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61} {0: 1, 1: 0, 2: 7, 3: 43, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!