ID: 985530022_985530023

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 985530022 985530023
Species Human (GRCh38) Human (GRCh38)
Location 5:428722-428744 5:428736-428758
Sequence CCAGTGGTAGCTCTGAGCTTGTT GAGCTTGTTTTCCTGTAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 24, 4: 151} {0: 1, 1: 52, 2: 44, 3: 45, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!