ID: 985537425_985537429

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 985537425 985537429
Species Human (GRCh38) Human (GRCh38)
Location 5:473104-473126 5:473124-473146
Sequence CCGCCGAACGCGCGTGCGCACTC CTCGGCAGCCCTCGGCGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 58} {0: 1, 1: 0, 2: 4, 3: 12, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!