ID: 985537581_985537597

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 985537581 985537597
Species Human (GRCh38) Human (GRCh38)
Location 5:473603-473625 5:473651-473673
Sequence CCCCCGCCGGGGGTCCCGGGACA CCGCCCCAGGCCCTGCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!