ID: 985541293_985541308

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 985541293 985541308
Species Human (GRCh38) Human (GRCh38)
Location 5:488845-488867 5:488882-488904
Sequence CCAGGACGGGCCCGGAGCCGGGA GGGCGCGGCCAGGGAGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!