ID: 985547753_985547765

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 985547753 985547765
Species Human (GRCh38) Human (GRCh38)
Location 5:518641-518663 5:518663-518685
Sequence CCCAGTGCAGCCCCTGGCTCCTG GGAGAAGCCGGCAGTGGGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 66, 4: 765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!