ID: 985571135_985571145

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 985571135 985571145
Species Human (GRCh38) Human (GRCh38)
Location 5:645954-645976 5:646007-646029
Sequence CCCGTTGGCGCCCTGTGTGGATG GTCACTCTTGCTCCCATCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 4, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!