ID: 985572049_985572058

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 985572049 985572058
Species Human (GRCh38) Human (GRCh38)
Location 5:652133-652155 5:652179-652201
Sequence CCTGGTGGGCCTGTCTGTGGCAG TCTCCTTGAGCACTGTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 286} {0: 1, 1: 0, 2: 2, 3: 21, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!