ID: 985576215_985576220

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 985576215 985576220
Species Human (GRCh38) Human (GRCh38)
Location 5:674626-674648 5:674645-674667
Sequence CCACCAGAGCGGCCCTGGTCACC CACCAGGACCTGCCAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176} {0: 1, 1: 0, 2: 4, 3: 49, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!