ID: 985589925_985589930

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 985589925 985589930
Species Human (GRCh38) Human (GRCh38)
Location 5:759257-759279 5:759286-759308
Sequence CCCTGCGCCCTTTGTTAACACTG TTTCCCCCGCCCTGTTCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!