ID: 985602642_985602658

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 985602642 985602658
Species Human (GRCh38) Human (GRCh38)
Location 5:843244-843266 5:843278-843300
Sequence CCCCCACCCTCCCACAACTACAT ATGGTGTGACAGGTGCTACAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 10, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!