ID: 985604010_985604013

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 985604010 985604013
Species Human (GRCh38) Human (GRCh38)
Location 5:849105-849127 5:849118-849140
Sequence CCGTCGGCCCTGCACACACAGCC ACACACAGCCCTGCTTACCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 31, 4: 388} {0: 1, 1: 1, 2: 2, 3: 29, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!