ID: 985604022_985604028

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 985604022 985604028
Species Human (GRCh38) Human (GRCh38)
Location 5:849161-849183 5:849181-849203
Sequence CCATTGGCCCTGCATACACAGCC GCCCTGTGCCAGTCGGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 206} {0: 2, 1: 0, 2: 1, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!