ID: 985604344_985604350

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 985604344 985604350
Species Human (GRCh38) Human (GRCh38)
Location 5:850429-850451 5:850458-850480
Sequence CCCGAAGGTGGCCGAGGAAAGGC AGACAGCCCAGGTCACCACCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 195} {0: 1, 1: 2, 2: 4, 3: 12, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!