ID: 985604344_985604355

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 985604344 985604355
Species Human (GRCh38) Human (GRCh38)
Location 5:850429-850451 5:850472-850494
Sequence CCCGAAGGTGGCCGAGGAAAGGC ACCACCTGGAAGTAGTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 195} {0: 1, 1: 1, 2: 1, 3: 14, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!