ID: 985606779_985606784

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 985606779 985606784
Species Human (GRCh38) Human (GRCh38)
Location 5:862154-862176 5:862167-862189
Sequence CCCTCTAAGTCCTGCAGGATCAG GCAGGATCAGCTGACCAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 33, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!