ID: 985611381_985611388

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 985611381 985611388
Species Human (GRCh38) Human (GRCh38)
Location 5:891539-891561 5:891557-891579
Sequence CCTCCTCCAGCCACGCAGGCGCA GCGCACTCTGCCTGGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 237} {0: 1, 1: 0, 2: 2, 3: 17, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!