ID: 985628956_985628969

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 985628956 985628969
Species Human (GRCh38) Human (GRCh38)
Location 5:1005035-1005057 5:1005073-1005095
Sequence CCTGCGGCCGCACCTCCTCCTCC CCCTGCCCCGCCCGCGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 140, 4: 989} {0: 1, 1: 0, 2: 4, 3: 62, 4: 498}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!