ID: 985632058_985632066

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 985632058 985632066
Species Human (GRCh38) Human (GRCh38)
Location 5:1018881-1018903 5:1018918-1018940
Sequence CCACAGGGAGGAACATCCTTGGC AGAGCACCATCCCTGCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 202} {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!