ID: 985636301_985636311

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 985636301 985636311
Species Human (GRCh38) Human (GRCh38)
Location 5:1037510-1037532 5:1037554-1037576
Sequence CCCCAAGCAGGGTCTCAGCTGTG CAGGACACACAGTGGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 210} {0: 1, 1: 0, 2: 5, 3: 41, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!