ID: 985643598_985643614

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 985643598 985643614
Species Human (GRCh38) Human (GRCh38)
Location 5:1074826-1074848 5:1074869-1074891
Sequence CCCTGAAGGGAGCCCGTCCTAGG CTGTGGCTGTGGAGGGAACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 79} {0: 1, 1: 0, 2: 2, 3: 37, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!