ID: 985645226_985645238

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 985645226 985645238
Species Human (GRCh38) Human (GRCh38)
Location 5:1081811-1081833 5:1081829-1081851
Sequence CCCACTCCCCGGCAGGTGCCACT CCACTGGTGGCCGGAGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 259} {0: 1, 1: 0, 2: 4, 3: 25, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!