|
Left Crispr |
Right Crispr |
| Crispr ID |
985677714 |
985677720 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:1240815-1240837
|
5:1240851-1240873
|
| Sequence |
CCAAAACTTCAGAATGTGACCTG |
CTTTGCAGATGTAATTAAGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 33, 3: 222, 4: 822} |
{0: 2, 1: 9, 2: 28, 3: 67, 4: 258} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|