ID: 985678368_985678380

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 985678368 985678380
Species Human (GRCh38) Human (GRCh38)
Location 5:1243780-1243802 5:1243823-1243845
Sequence CCCTGGAGGACCCGTCCCCAGCA CGCTGTCCAGACGCCCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 181} {0: 1, 1: 0, 2: 0, 3: 12, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!