ID: 985681240_985681244

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 985681240 985681244
Species Human (GRCh38) Human (GRCh38)
Location 5:1256989-1257011 5:1257014-1257036
Sequence CCGTGAAATCGGGGCCCAGCTCT GTTCTCCCACTCCTGCCTCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 19, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!