ID: 985694073_985694080

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 985694073 985694080
Species Human (GRCh38) Human (GRCh38)
Location 5:1330146-1330168 5:1330186-1330208
Sequence CCAGAACACTGAGGCCATCGGGA CACAGAAGGTCTCAGGTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135} {0: 1, 1: 0, 2: 4, 3: 32, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!